Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11696C9
Clone ID IST11696C9
Vector VICTR76
Project tigm

Sequence tag IST11696C9HMR1
Sequence
ATCTTTCTGCAAACCGACCCTATTCGACTCTACTCAAGGGTTAGAATGTGTGCTTGGGACTCTGTACTTGGCTGGCGGGG
TTGTGGACCCATGGGGACAAGAGATAGACTTAGGGGAGTTTACACAAACTTTATGGATAGAGAGCAGTACAGTGAAGAGA
GGTGTGGGAAAGCAGTGGTGCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI22489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54787870..54788055 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

 
Come back to gene ENSMUSG00000034928


For any suggestions or comments, please send an email to unitrap@crg.es