Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_152B2-3
Clone ID CMHD-GT_152B2-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_152B2-3
Sequence
GGATTTTTATGCTCCGACAAGTGCTGTGGAGAACATACTGGAACACTTGGCACAAGACATTGACGTGGTTAGACCAAATA
TTGTGAAACACCCTCTGACCCAGGAAGTAAAAGAGTGTGACGGCATAGTCCCAGTCCCACTTGAAGAAAAACTGTATTCA
ACAAAGAGGAGGAAGAAGTGAGAAGATTCACCAGATTCTGGGCCTTATATTTAATCCTAAGGGCACTATGGGTGCTGCTA
GGTTGTTGTCTAGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAACTGCTGGCCGAGACCTGCCCTGATGT
CTCTGCTGAGATTTCATCCCACTTGTGGGGTTTGTCGGGAGTGGGGGTGTTCACAGTACCACTGTAGCGTTTCCAAGAGC
AAAATGTTTGTCATTCACACTTGGTTGTCTTGCAAGCCTATATGGAACACTGGGAGCAGAGTAATAAACATGACTTTATC
ANCC
Sequence Type mRNA
Unitrap ID UNI13554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 92111990..92112469 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039680 (Mrps6) NM_080456 mitochondrial ribosomal protein S6 Gene [Source:MGI (curated);Acc:Mrps6-001]

 
Come back to gene ENSMUSG00000039680


For any suggestions or comments, please send an email to unitrap@crg.es