Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13554C3
Clone ID IST13554C3
Vector VICTR74
Project tigm

Sequence tag IST13554C3HMF2
Sequence
TTGGGATCTGATGCATCTGAACTCTGCAACAGTGTACTCACATATATAAAATAAATACATCTTAAAAAAAACAAAACAAA
N
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114314482..114314560 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST13554C3BBF1
Sequence
AGANAATGGAATCGGGCCTTCCTCCTCGCCCAACGCCAGTTAGGAACTGTACATTGCTGCACCCTAATAACAGCAGTTTC
CTCNAGGGGTGCTANAAGGCTCCNCAAGCCCAAGCCTCGTCCCTGAAACCCGGCNNCCAGGTGGAGGGCCNTTTCCACTC
GGCTGCCCCGGGTGGCANGTCNCATCCNTCTTCCCCGCCCCTCGCCCAANTAANCNGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es