Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10042A4
Clone ID IST10042A4
Vector VICTR75
Project tigm

Sequence tag IST10042A4BBR1
Sequence
CTCCTTGGACAGAGCATTGCCTGTGGTGGAGGAAGCTCTTCTTGGTAGATAGAGAGCCCAAAGGAGTGTAGCTTTGGGTG
TGATTTCTCCTTCCTTCCTCTGCGTTCCGTACTGCCTTAACCCCCAGCCCATGGGATGGTACCACCCACATTCAAGGCAG
GTCTTCCCTTCAGCTAATCCTATCTGTATGTATCTTCAAACACAGCCACAAATGGACCACAACAGCCCCTGGGTGGTTCT
AGATCC
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153297..104153541 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST10042A4HMF1
Sequence
GGAGGACACAGGAGCCCATGAGCCAAAACAAAGCTTTCCTCACTGAGTCATCTCTGTCAGGTGTCTGGGCACTCAGGAGA
TGTTCCATGGGAAAAGGTGGCCTCTAAGCTCCTGCAGAGATGCCACTGTCCCCTCCTACCCACCTGCCCCGCACTAGCTC
AGAGCAGCGGCTGGTTTAGAACAAGGCTGTGGGCCTGACTGTCACATCTGACTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153083..104153300 218
NO GENE  

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es