Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14262F2
Clone ID IST14262F2
Vector VICTR74
Project tigm

Sequence tag IST14262F2HMR1
Sequence
CCAGCAACCNCATGGTGGCTCACAACCATCTGTAATGAGATTTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGT
GTACTTANATATAATAATAAATCTTTTTATTTTTTAAAAAGGTGAGAAATAATTANTATTGGTAGGGAGAAAAAAAGAAA
AGATATGTGCAGTTGGGTATGATGATGCAAGCCCGTGAGCCTAGCACTGAAGAAGCCAAGT
Sequence Type genomic DNA
Unitrap ID UNI6927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9155886..9156106 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]


Sequence tag IST14262F2HMF1
Sequence
CTGGGATTTGAACTCAGGACCTTCAGAAGAGCACTCAGTGCTCTTAATCGCTGAGCTATCTCTCCAGCCCTATTCCTCAC
CATTTTAATAAGTATAAAATAGCTGTCTAGTCAGGAAGTGTTGGGGGAGAGTGTTTAAGGTTACAGTATTTACAGAGCTC
CTTAATGAACACCTCCAAACCTAACATAGTCCTCCTTCATCCTCCCTCCCTCACACACACACCACCTTAGGCAATATTTA
AAAGAAAATGTATCTATTAATGTGTAATTTAAAAAACACGTTNNNNGTTTTTTCCCTAAAGGAACAAAACTCTGCNNAGC
ANCAAATTATTGGCAGATAATAAATTCCTAAATCTCATACCTAGGTACATATAAAAGTGTTAGAAAACATACAAGCCTAC
ACAATAATATCTTCAGAAGTACTTACAATTTCATATAGGAACACTTTGTGCTTAACGTAGAANGCTNTGGAATGGTTGAN
GCNGATCAGANCCNCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9156103..9156600 472
 
EST/CDNA Est Name
  BB644773.1 - BY736719.1 - BY727539.1 - BU510929.1 - BB621627.1 - DV074837.1 - BB616591.1 - CD547372.1 - CN702271.1 - CF171434.1 - BB613625.1 - CA876826.1 - CF166105.1 - CF167966.1 - CK620905.1 - CF168565.1 - CA894252.1 - CF896108.1 - CF166094.1 - CF170555

 
Come back to gene BB644773.1 - BY736719.1 - BY727539.1 - BU510929.1 - BB621627.1 - DV074837.1 - BB616591.1 - CD547372.1 - CN702271.1 - CF171434.1 - BB613625.1 - CA876826.1 - CF166105.1 - CF167966.1 - CK620905.1 - CF168565.1 - CA894252.1 - CF896108.1 - CF166094.1 - CF170555


For any suggestions or comments, please send an email to unitrap@crg.es