Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10005G1
Clone ID IST10005G1
Vector VICTR76
Project tigm

Sequence tag IST10005G1BBF1
Sequence
ACAGAAAAGGCAACCGAGGCTCAGGAAGATTAAAAAATTTGCTAAGTCATGCCCTTGGAAAATCATAATGTCCAGCTTTG
AGCATCTCCCAACCAACAAGGGCAGTCTTCAGATATTTAGACTCACCCACACCCGGGACACTCGGCTGAAAGGAACCTCA
TATTCAGAAGTGTGGCACGACATCTCCTGTACTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90946568..90946762 195
NO GENE  


Sequence tag IST10005G1BBR1
Sequence
CTGTGAAATAGGTATAGTATGATGGTACCCTATGGGAAGGATAGAAATATGTACATAGCTTTGTTGGGAGGCCAGAAAGA
GATGGCAGTCCCAGAGAATCTCATCTAACACCTGGCATATGGTAGGCACCGTACAGATCC
Sequence Type genomic DNA
Unitrap ID UNI2783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90946759..90946897 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]


Sequence tag IST10005G1HMF1
Sequence
GCCNTTACTTTACTTTTTAATTTAATTCATTCTTTGACAATTTCATACATATATACAAGAAAGCTGGATTATAGTCATCT
TTTGATTATGTTCACCCCACTTCTCAATTCCTACAATCCTCCCCAACTGGTGCTCCTCCCACTTTCATGTCCTTTATATG
TATGGATGCCTTGTCTGCTTGCATCTCTGTGCACCCCANGCATGTACTGNCNTNGGAACTGGANGTAGGGAAGGTTGTGA
GCTCAACGTGACAGTACTTGAANTTGAACACANGTCCTCTGAAAGANCAAACAATGCCCTTCANTACAAAGCCATCTCTC
NAGCACCTCCACCCTTTTCCTCAATAAGCCNCTGANTCNGTCCAATTAGTGCAACCNNNANGANCATGGGNNACCTGANG
AAGAAATGGCTCCCCCTCCAGCAGCCATCNGCNGNGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es