Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10765B11
Clone ID IST10765B11
Vector VICTR76
Project tigm

Sequence tag IST10765B11BBF1
Sequence
CAACAAGGTCCAATTGCTAAGGAAAGAACGTAGCCGCACGTCTGCCTGTGCTTCAACCTCCCTCTTACAAGTCCTACGCC
ATGTCACTTTCAGTCATGCCCATCCCACATCAGCTGTGTAGCATGCGCGTAGCTGATGGGTGCCCAAGAGGGCAGAGTTG
CCGTCCTTTCTTACTGGAAGGGCGGTGGAGAGGGCTGCTTTGAGCTGTGACTCGCCTTCTTTGTGTTGAGATTTTGTTTA
TCCTTTTCTCCATTTGTTTCCATTCCCCGTGTGCTGACTTTCATTTTGATTTTATTTATGTTTATGTTTAAGACATCCAC
ACCTTCCTGTGCTAAAGCCCCGAGCCATAGGCCCTGCCTTAGCCCCACACGCCCCACTCTTGGTAGCTCAGACCCTTTGA
TCAAACCCTCCAGCCCTGCCGTGTGCCCTGAACCAGCCACCTCTCCTAAACACGTCTCTTCTGTCACACCCCGAAATGGC
AGTCCTGGAACNAAA

Sequence Type genomic DNA
Unitrap ID UNI32177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104166214..104166707 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST10765B11HMR1
Sequence
TTGTAGGTCCGACTTGGAGAGTGCTGGCCTAAAGGTGTTTCCCACTTAGTAAAGCAGGTGGAGACCGCCAGAAAAGAGGC
AGCAAGATTTTCTCAAGAAAGAATGTTACTGTGACGTGGGTCAGAGGCTCAACCTCAGGAGAAGCACTTATGCAGGCTCA
CTAACACCCTACCCTCTCGCTCTACTATGCCCAAAAAACACCAAAAAGCCAAACCCTAATACTTCAAGGAGGATTGTGCC
NNANTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104165977..104166216 240
NO GENE  

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es