Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14305C1
Clone ID IST14305C1
Vector VICTR74
Project tigm

Sequence tag IST14305C1HMF1
Sequence
AATAAGGAATTCCTACGCACAAAGAAAGTAGGGAGGAATCCTTAAAGCACCCACAGGGAGGAGATGATTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28116144..28116216 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST14305C1BBF1
Sequence
GTCGGAACTACGACGGTATCTGATCGTCTTCGAACCTCCGACTTTCGTTCTTGATTAATGAAAACATTCTTGGCAAATGC
TTTCGCTCTGGTCCGTCTTGCGCCGGTCCAAGAATTTCACCTCTAGCGGCGCAATACGAATGCCCCCGGCCGTCCCTCTT
AATCATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGG
CTCGGGCCTGCTTTGAACACTCTAATTTTTTCAAAGTAAACGCTTCGGGCCCCGCGGGACACTCAGCTAAGAGCATCGAG
GGGGCGCCGAGAGGCAAGGGGCGGNGNCGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 39984033..39984382 340
 
EST/CDNA Est Name
  BM217938.1 - BM197973.1 - CR521004.1 - AU020382.1 - BM122821.1 - BG796972.1 - AA407434.1 - CN688877.1 - DV070776.1 - CV304202.1 - CN686876.1 - BM231084.1 - BM199275.1 - BM199098.1 - BM235281.1 - CV308958.1 - CV304509.1 - CV306868.1 - CV307112.1 - CV305382
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3151177..3151526 340
 
EST/CDNA Est Name
  BF318965.1 - BF318969.1 - CN690481.1 - BM197973.1 - CR521004.1 - AU020382.1 - BM122821.1 - BG796972.1 - AA407434.1 - CN688877.1 - DV070776.1 - CV304202.1 - CN686876.1 - BM231084.1 - BM235281.1 - CV308958.1 - CV304509.1 - CV306868.1 - CV307112.1 - CV305382

 
Come back to gene BF318965.1 - BF318969.1 - CN690481.1 - BM197973.1 - CR521004.1 - AU020382.1 - BM122821.1 - BG796972.1 - AA407434.1 - CN688877.1 - DV070776.1 - CV304202.1 - CN686876.1 - BM231084.1 - BM235281.1 - CV308958.1 - CV304509.1 - CV306868.1 - CV307112.1 - CV305382


For any suggestions or comments, please send an email to unitrap@crg.es