Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12074C7
Clone ID IST12074C7
Vector VICTR76
Project tigm

Sequence tag IST12074C7BBF1
Sequence
CCCACCTGGGATTGGGTATAATTAATTCATAGTGATTTCAAATGATGTACCGCTGAACCACCTCCTCAGCCCAAATTGCA
GTTAAATTTGT
Sequence Type genomic DNA
Unitrap ID UNI27998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53500907..53500997 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055069 (Rab39) NM_175562 RAB39, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab39-001]


Sequence tag IST12074C7HMF1
Sequence
CCCACCTGGGATTGGGTATAATTAATTCATAGTGATTTCAAATGATGTACCGCTGAACCACCTCCTCAGCCCAAATTGCA
GTTAAATTTGTTTTTTTTTTTNAN
Sequence Type genomic DNA
Unitrap ID UNI27998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53500897..53500997 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055069 (Rab39) NM_175562 RAB39, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab39-001]

 
Come back to gene ENSMUSG00000055069


For any suggestions or comments, please send an email to unitrap@crg.es