Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10389E11
Clone ID IST10389E11
Vector VICTR76
Project tigm

Sequence tag IST10389E11HMF1
Sequence
CCACCACAATTTCCCCGAATAATTTTATGAAAGTAAGAATTGATTCAATTCTAATCCTTTCTTTGAACAGGTTAATCTCC
GAGTCCCTGACAAGGAAGGCAACTTGCTACAAACCAACAAGTTTGTGACAGACTTTAAACTAAAATCTTAAGTGTCTCCA
GAAATGTTAAATCGGGTCTCCCGAGTTCTAAACAACGGCTCACGTTTTTATAGAGTCACAAACGGCAGTCAGAGAACCCG
GATCACANAACTTCTCGCTGAAGGTTGTCCCNNATATTCACACCCAACCCAAACCCACCCNAGAAAATCAAGTTATCCCT
TANGGTTGTGAATCGCCAAAGGGCTTCTGACACTGTTGCCCACTGGCCCCGCGTAGCCNTGTTATCTCACACCTAGCGGG
ACAGGCTAGCCACACCCTCACCTGAACTACAATCTGAGTGGCNACTCTTGGCCTACTACTCANNNGNCAATTCCCGCATC
ANGTAGAANGGGCCACTTCCAGCNNTCA
Sequence Type genomic DNA
Unitrap ID UNI34083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84518779..84519281 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050043 (Txndc14) NM_025868 thioredoxin domain containing 14 Gene [Source:MGI (curated);Acc:Txndc14-001]

 
Come back to gene ENSMUSG00000050043


For any suggestions or comments, please send an email to unitrap@crg.es