Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14752A6
Clone ID IST14752A6
Vector VICTR76
Project tigm

Sequence tag IST14752A6BBF1
Sequence
ATCCAAAGGCTTTTACGTCAGTCATCATGGTACACCTGTTATGCTAGCCCTTAGGAGGCAGAGGCTAGTGGATCTCTGTG
AGTTCAAAGACACAAGTTCTCAGCTGAATGAATGAATGAATGAATGAATGAAAAATGGTTAACAAGAAGGTAAAGACCTT
TCTTTTAACTAATAGATGAAAACATTCGTGTCCATAAAGCAGAATTATCTGATATCTACAGTATTTGGCATCTCATTTAA
GACACAACATGCCCTGAGCCATCTCAGGACATCTGTCCCCACCCCAGGCTCACAGATACAACCCCATGAGTCACACATAA
CGATCCCTTCCTGTTCTCTTTCNCACTTTGCTCTAAAACCACTATGGGGTCCCCTGANNCACANGTCATGGGCTTGCGTT
TCTGTTNGNNNGNCTGCGTTTTTAATCCTNNGGCNCANAGTTNANCANNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121215028..121215474 417
NO GENE  


Sequence tag IST14752A6HMR1
Sequence
TGCTTANAAACGTTGAACCTANCATAAAACCCTCTCTTCTTTTTCTTTGAGGATCAAACTCAN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121215534..121215595 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14752A6HMF1
Sequence
ATCCAAAGGCTTTTACGTCAGTCATCATGGTACACCTGTTATGCTAGCCCTTAGGAGGCAGAGGCTAGTGGATCTCTGTG
AGTTCAAAGACACAAGTTCTCAGCTGAATGAATGAATGAATGAATGAATGAAAAATGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121215332..121215474 143
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es