Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12917D2
Clone ID IST12917D2
Vector VICTR76
Project tigm

Sequence tag IST12917D2HMF1
Sequence
GGAGAAAACTTAGGATCGGTTTACTAGGCTACTCTGCACGAGGGAACTCTTTGCTGCCGCGATCTCTCCGTAGTATCAGA
TTATAAGTGGCTTCTTTTTACTAGCATGCTAATACTTGGCTAAAAATAAAGGTACTTTGTAAATGAAAGATTANATGATC
CCGGAACCAGAGCTGGGAAGGTTTGGTTAGGAAAATGGAGGCTTCCCGGANAAAATTTGTGTGTGAATGGGAGACTCGAG
GGATNNNNNTCTGGTTTAN
Sequence Type genomic DNA
Unitrap ID UNI14400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74714933..74715190 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es