Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_148F3-3
Clone ID CMHD-GT_148F3-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_148F3-3
Sequence
CCGGAAAGGACAGGAGCGACTTAACCGCTGGTTCCTGACGGGCATGACTGTGAATGAAGTGGTTCTGCTGGGCTCACTCT
TCAGTCGGAAGTGACCAGACACTGACCGTCCACTCACCTCTCACCTCCCACCCTGCCCCCACCACAACTCTCTCTTCAGC
CACCATTGCTACCAGGAGAACCACTACATGCAACTCACGCCCCTTGCCCTATCACAGGGTTGGGCCTAGACGGAGTCCCC
TGCAATTAGCTTTCTAGGATCTACCACACTTCTGTGAAAGCCACCTTCCCCCCACATCTCAGTTCTCTTGGCCTCAAAAC
TCACAAGGTTTTCCCCTAAACCAGCTCCTTGGAGGCTGGCAGGAGCAGAGAGGGGTGTGTGAGGGAGGAGAGCCTGTCTT
GTTGGTGGGACCCTAATTACCCCTGAGCCTCTCGGGAATGCTTTTCCAGCAGGGAGCTCTTCCCCTGAAGGAGACTAGCT
TGCCTTGGTTTTGATGTGTGTGGCCTCAGACGTGATCATTTCCCATCCCGCTGTGTCTCTGGGTCTCCCTCCTCCCCATC
TCCACCCCCCAAGAGCCATTGAGTGAGGTGCTTTTAGCCCTTTTGACTAATTAGAAATTTCGGCTGCTTTGGGATAATGA
GACAAGGACCAAAACCTCCTCCCCAC
Sequence Type mRNA
Unitrap ID UNI13038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152607310..152607974 640
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es