Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14624G9
Clone ID IST14624G9
Vector VICTR74
Project tigm

Sequence tag IST14624G9HMR1
Sequence
NNGTATGCTTTCATTAATTTTGGCCCTTTTAACANAGATAGGGAACATGCATATATAGTCACATATGAAATGCATACTCA
TGTANATTCAAATACATGCACATGTCTTGATCATANAGAC
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35527213..35527329 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


Sequence tag IST14624G9BBF1
Sequence
TACCTAGTGCATAAAACCTGATCCCTAAGGACTCTCCAACCAATTCCCAGAAATGGACCTTAGCAGATAGTATAAAATGA
ACCTATGTTATTCAGAAAGAGAGGAATTTCTCCAGAATGAGAGTCCTGTCATGAAGACCAAACATGCCTGTTGCCAGAGA
GACCAGAAGGCAGCCATGGAATTGGAGTTACCAGTGGCTGGAGCTTCCATGTANATACTAAAAATCAAATCCAGGTACTC
AAAAAAGCANCCAGTACTCTCAATTGNTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35526950..35527215 262
NO GENE  


Sequence tag IST14624G9HMF1
Sequence
TACCTAGTGCATAAAACCTGATCCCTAAGGACTCTCCAACCAATTCCCAGAAATGGACCTTAGCAGATAGTATAAAATGA
ACCTATGTTATTCAGAAAGAGAGGAATTTCTCCAGAATGAGAGTCCTGTCATGAAGACCAAACATGCCTGTTGCCAGAGA
GACCAGAAGGCAGCCATGGAATTGGAGTTACCAGTGGCTGGAGCTTCCATGTAGATACTAAAAATCAAATCCAGGTACTC
AAAAAAGCAGCCAGTACTCTCAATTGCTGAACAATCACTCCAGGTCCTATTTTTAATTTTAAAAGCACCTGAACTGGGGT
TGGAGAGATACTTCAGCAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35526875..35527215 341
NO GENE  

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es