Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14792H11
Clone ID IST14792H11
Vector VICTR76
Project tigm

Sequence tag IST14792H11HMR1
Sequence
GGAAGANAGGACAGGAACTCAAGCAGGTCAGGAAGCAGGAGCTGATGCAGAGGCTATGGAGGGATCTTACTTACTGGCTT
GCTCAACCTGCTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104120750..104120847 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14792H11HMF1
Sequence
NAAAGGANATTGANAGCCCTGNNNGTTTTCCAAGTTTTCACCTANNAGGGTGGAACATGATTANNGCANAAAGAGTGTGC
GGAGGANCANATGGGCGAGCCACCCCGGANCTGGGCTCTGTGTTTACATAACANTCNTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14792H11BBF2
Sequence
TTCCTTTGGTGATGGACAGCAATGTGGAAGTATAAGCTGAATAAGCCCTTTCCTCCCTAACTTGATGTTTTGTGCAGGAC
TAGAAACCCTGACTAAAGCACACCAGGACACCAGGTGGCTGGGAGCAGCTCTCCTGGTTGAGATGGGTGAGTTGGCCTAA
GGATGGCTCTGGGGACAGGAAGCCGTGGTGCCTGTGTAATAGAAATGAATGGTTCCCGAGGGAGCCCAGGAGCTGATGTC
CTGGGTCACATGACAGGATGTCACAGTTATTCCCCGGGTCTGTGAGCTCTGGCCTTTCTTCCCCAGCTCTGGCACTGATG
GGAGTCTTGTTTACCTTCANANGCTGGGTGAGGAATGAACAGGTTAACAAGGCTTCANGCCTGGAGGCAGGANNANNNAC
CCANGGCTCCNCTGTGTCTGGGGGTTGTGCGTAANCNTGCCCCNNTCTCACGACCTCTGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104120294..104120753 432
 
EST/CDNA Est Name
  BI202659.1

 
Come back to gene BI202659.1


For any suggestions or comments, please send an email to unitrap@crg.es