Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14861A2
Clone ID IST14861A2
Vector VICTR76
Project tigm

Sequence tag IST14861A2BBF1
Sequence
GCGTCCAGGACACAATCCCAACACAGGATGAGGCTGGGTGAGACCTGGAGACTAGCCGAGGCTACAAAAAGATGGCGTAC
CCAAGAAGAGATAAAAATAAAGAAAAGAAAAAGGAGAGAAAGGCAGAAAAGAGAGAGGCAGGGAAGGAAAAAAGAAGGAT
TGAATGAATTGTTTTGCACGGGGGGTAGGGGGACAGCTCAATGATGGGGTGCTTGTCCGACATGTGTTAAGGCCCTGGGT
TTTNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81990618..81990863 244
NO GENE  


Sequence tag IST14861A2HMF1
Sequence
GCGTCCAGGACACAATCCCAACACAGGATGAGGCTGGGTGAGACCTGGAGACTAGCCGAGGCTACAAAAAGATGGCGTAC
CCAAGAAGAGATAAAAATAAAGAAAAGAAAAAGGAGAGAAAGGCAGAAAAGAGAGAGGCAGGGAAGGAAAAAAGAAGGAT
TGAATGAATTGTTTTGCACGGGGGGTAGGGGGACANCTCANTGNNGGGGTGCNNGNCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81990652..81990863 204
NO GENE  


Sequence tag IST14861A2HMR1
Sequence
ACGCCATGTCCAGCTGAGTGCTTTTTTCCTTGCTCTGTAGGGTCCCACGAGGCACGGAAGGCCATCCGAGCTGTCAGACA
CAGAGTGAGCATCACAGACAAGTGCCAAGTGGATGGTGGTGTANCATTCAAGAACCTACTGTACTGTGGGTTTGGTCTTT
GTTTATGGAGGTTTGAN
Sequence Type genomic DNA
Unitrap ID UNI5488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81990860..81991035 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es