Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13403E11
Clone ID IST13403E11
Vector VICTR74
Project tigm

Sequence tag IST13403E11BBF1
Sequence
GTATAACCAAGATCCTTCCAACTCACCAAGCTGGAGAACTCTAAGCCCGGGAACATCCAAAGTGCACCCAGCAAAGCCAA
GGGGGATGAGAATAGGAGCTTCCATTTATCCTGTGTCTACTAAGTAACAGACACAAAACTACATGCTTTGTCTGCTCTTA
AATCATTAGCGAATTGAGGTCCAAGGACGTTGGTACGTACCTGACACAGAGACAAAGCGTTACTCTGG
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96478046..96478272 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST13403E11HMF1
Sequence
GTATAACCAAGATCCTTCCAACTCACCAAGCTGGAGAACTCTAAGCCCGGGAACATCCAAAGTGCACCCAGCAAAGCCAA
GGGGGATGANAATAGGAGCTTCCATTTATCCTGTGTCTACTAAGTAACAGACACAAAACTACATGCTTTGTCTGCTCTTA
AATCATTAGCGAATTGAGGTCCAAGGACGTTGGTACGTACCTGACACAGANACAAAGCGTTACTCTGAANATTGTCGAGC
ANGNCCNGNNGANACACACN
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96478046..96478304 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es