Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12284C1
Clone ID IST12284C1
Vector VICTR76
Project tigm

Sequence tag IST12284C1BBF1
Sequence
GCCNTTGCCACGAGTGACATTCCAGCAGCTTGAAATTGTTGTTTGAGCTGATTTGGGGAATTCTGTATGAATGGAGGCCT
TACCGCAAATCCTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTCCCAGCCTCAAGGCCTTTGCCTGAGC
TGATCCAGCCAGTTGGCTTTCTCATCTTCTCTACCTCTTCTGCTTTGTGAATTCATTTCAGCAAGCTCTTCCTGCGGAGC
AGCTTTGTTTGTGCTCTGTGTCTGTGCTCTCCTCCATGGACAGACCTTTGATGCTAATTCAGTGGTAGCCACACGAGACT
TCCTTAGCTCTTGAAATGCCATGTCCTTCTGANAATTTAATCTCCCTTCNAGGATTTGGCCNCTGCTACCTTTTTGGGAC
AGACTTCTCATCTTTACTGTTAGCTTGAGTCTTGGCGTTGAGTGTGTCTCGATTTTAAAGGTGCCATTCNNGCTGGANGT
CAGANGTCTGCNAGCGTGTTNNNGANCNNANCCNCCCATCTGCCATTTGCTTTTCNCTTGCTN
Sequence Type genomic DNA
Unitrap ID UNI402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59612036..59612577 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST12284C1HMF1
Sequence
GCCNTTGCCACGAGTGACATTCCAGCAGCTTGAAATTGTTGTTTGAGCTGATTTGGGGAATTCTGTATGAATGGAGGCCT
TACCGCAAATCCTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTCCCAGCCTCAAGGCCTTTGCCTGAGC
TGATCCAGCCAGTTGGCTTTCTCATCTTCTCTACCTCTTCTGCTTTGTGAATTCATTTCAGCAAGCTCTTCCTGCGGAGC
AGCTTTGTTTGTGCTCTGTGTCTGTGCTCTCCTCCATGGACAGACCTTTGATGCTAATTCAGTGGTAGCCACACGAGACT
TCCTTAGCTCTTGAAATGCCATGTCCTTCTGAGAATTTAATCTCCCTTCAAGGATTTGGA
Sequence Type genomic DNA
Unitrap ID UNI402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59612036..59612414 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es