Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14608B10
Clone ID IST14608B10
Vector VICTR74
Project tigm

Sequence tag IST14608B10HMR1
Sequence
CCTCTGCCTCTTGAGTGATGGGAACAAAGGCGTGCGCCACCACGCCAGGCTTTTAAGTTTATTTTTTATGGCACTGGGGA
ATCAAACCTATGTCCTGTGCCTCTTTTGAGACAGGCTATCCCTGCTAGGTAGGANCTCTTGATCCTCCTGCTTCAGCCTC
CCAAGTGCTGAGGTTTGGANCCCANANCCACCCTACCTACCTATCCCTTTTTAAAAAATCTTATCTTCTTATTTAATTGC
ANCCNNATGTGNCNATNGTCC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060933..6061192 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14608B10BBF1
Sequence
NNNNNGGTCTACAAAGTGANNNNCAGGACAGCCAGAGCTACACAGAGAAACCCAGTCTCGAAAAACCAACAAAACAAAAC
AAAACAAAACTTAATCNNNNANNTAAATCAAATCCTGGTGGAGGGGCGAGGTGGCTGCGGTTAAAGGGCTTGAAGGTCTG
AATTCAGTCCCAAGAGGCCATGGGAAGTCAAAAGGAAAGAACAGACTTTGTTAGGTCTCAAAGAAACCTGGGAGGAACGG
CAAGGTCCCTATTAACATATCAGAACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6061223..6061489 247
NO GENE  


Sequence tag IST14608B10HMF1
Sequence
AGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGAGCTACACAGAGAAACCCAGTCTCGAAAAACCAACAAAACAAAAC
AAAACAAAACTTAATCCATTACTTAAATCAAATCCTGGTGGAGGGGCGAGGTGGCTGCGGTTAAAGGGCTTGAAGGTCTG
AATTCAGTCCCAAGAGGCCATGGGAAGTCAAAAGGAAAGAACAGACTTTGTTAGGTCTCAAAGAAACCTGGGAGGAACGG
CAAGGTCCCTATTAACATATCAGAACAGATCTCAGCCAGTTCCCCCAAACCCAGAGCTTGTGGCTCCTCCCACTTCTCCC
AGCATCACTCANTGCCTGTGGCTCCTCCCACTTCTCCCAGTAACACTTTGAACTTGTAGCTCCNNACNCTAAACTTCTGG
GGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6061218..6061624 399
 
EST/CDNA Est Name
  CD539677.1 - CD540754.1

 
Come back to gene CD539677.1 - CD540754.1


For any suggestions or comments, please send an email to unitrap@crg.es