Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14205H4
Clone ID IST14205H4
Vector VICTR74
Project tigm

Sequence tag IST14205H4HMR1
Sequence
TAGCAACAGTGTANAACCCACCTGTCTTGAAGACTGACACCCCAATATNNCTCCGAGGAGTTTGGGGAGTACTTCCAATC
TGAACCAGACCTTGTCGATATTTACAGCATCCCTTGAGCCCCAGATCACGTGACCTATGGAGCCTCCGCATCCCCTCTGC
TTTGAGAATCACCCTAAAAGTGGAGGTCCCCACACATGATGTGTTTGCCCATCTCTTCATACTAAACCACACCATAAATC
ATTGTCTCAGGTAGCTTCCCCCAACCCTATCGTTCTTTANGACGTAAGANCCANNNGCCTGTGCTATGCTATACCAAATC
NNAAGTCTCTATGTTGGGTCCCTGAAAAATCCTGANAGCCTCATTTGAGTGGTCACCTGCTCCTGGGATCCATGCTGGCA
NCCCACCCCTGCTGGANTCTGTGCTNAANCNNCCAACAGCNANNTT
Sequence Type genomic DNA
Unitrap ID UNI34088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4126429..4126868 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024845 (Tmem134) NP_001072117 transmembrane protein 134 Gene [Source:MGI Symbol;Acc:MGI:1914240]

 
Come back to gene ENSMUSG00000024845


For any suggestions or comments, please send an email to unitrap@crg.es