Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12286F1
Clone ID IST12286F1
Vector VICTR76
Project tigm

Sequence tag IST12286F1HMF1
Sequence
GGCAGCAGCTCCTTCATTCACCCACTGAACACCGGAGGGTGGATTGGGACGACGTCAACN
Sequence Type genomic DNA
Unitrap ID UNI33816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25356727..25356785 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015083 (C8g) NM_027062 complement component 8, gamma polypeptide Gene [Source:MGI (curated);Acc:C8g-002]

 
Come back to gene ENSMUSG00000015083


For any suggestions or comments, please send an email to unitrap@crg.es