Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14248G6
Clone ID IST14248G6
Vector VICTR74
Project tigm

Sequence tag IST14248G6HMF2
Sequence
CTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTC
Sequence Type genomic DNA
Unitrap ID UNI27595 UNI29702 UNI31011 UNI31014 UNI31015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3831686..3831725 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34142838..34142877 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3329858..3329897 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16988044..16988083 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063358 (Mapk1) NM_001038663 mitogen-activated protein kinase 1 Gene [Source:MGI (curated);Acc:Mapk1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5915709..5915748 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23708044..23708083 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9791620..9791659 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6228235..6228274 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020456 (Ogdh) NM_010956 oxoglutarate dehydrogenase (lipoamide) Gene [Source:MGI (curated);Acc:Ogdh-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21087671..21087710 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9006518..9006557 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8247840..8247879 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273292..3273331 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 17265464..17265503 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007655 (Cav1) NM_007616 caveolin 1, caveolae protein Gene [Source:MGI (curated);Acc:Cav1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16877483..16877522 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33237654..33237693 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037426 (Depdc5) NM_177786 DEP domain containing 5 Gene [Source:MGI (curated);Acc:Depdc5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4896957..4896996 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51374087..51374126 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7374308..7374347 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031153 (Gripap1) NM_207670 GRIP1 associated protein 1 Gene [Source:MGI (curated);Acc:Gripap1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20819482..20819521 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59813597..59813636 40
NO GENE  


Sequence tag IST14248G6BBF1
Sequence
CTCATAGCACATCTTTTTCCCACTCAGACCAAAGCCACAATATGCACTCAATGCATTTCTTCATAGCGATGAATAACTGC
CATGGTGAATGACTGAGCTTGCCAAAAATGATCCTATATGAAAGCAACCAATCTGCTAAAAATACAAAGTCAAAAGTTAA
GAGCAAGCTGGGCGTGGTGGCACACGCCTTTAATTCCAGCACTCGGGAGGCAGANGCAGGTGGATTTCTGAGTTCGAGGC
CAGCCTGGTCTACAAAGTGAGTTCCAGGANAGCCNAGGCTACACAGANAAACCCTGTCTCGAAAAACCAGAAAAAACAAA
AAACAAAAACAAAAAAAGTTAAGANCAAACTGGAGTAAGGCTGGCTGTGGGGANTGTCCCCTANCACTCANTTCAGTTGT
AAATTAGCAGTGTTCNNACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134608899..134609319 401
 
EST/CDNA Est Name
  BG147042.1 - BG085543.2


Sequence tag IST14248G6HMR1
Sequence
CCANCAACCNCATGGTGGCTCACAACCNTCCGTAACAAGATCTGACTCCCTCTTCTGGTGTGTCNGANGACAGCTACAGT
GTACTTACATATAATAATAAATAAATCTTTAAAAAATTCATAATAAATGAAAAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BG147042.1 - BG085543.2


For any suggestions or comments, please send an email to unitrap@crg.es