Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0106
Clone ID AL0106
Vector pGT0lxr
Project sanger

Sequence tag AL0106
Sequence
TTTCTTTAATGCTAATTGGGAAAGAGACAGAACCACCCAGACTGGTGTTGAACCTTGCTATGGTGATAAAGATAAACGGC
GACATTGTTTTGCTACCTGGAAGAATATTTCTGGTTCCATTGAAATAGTGAAGCAAGGTTGTTGGCTGGATGATATCAAC
TGCTATGACAGGACTGATTGTATAGAAAAAAAGACAGCCCTGAAGTGTACTTTTGTTGCTGTGAGGGCAATATGTGTAAT
GAAAAGTTCTCTTATTTTCCGGAGATGGAAGTCACACAGCCCACTTCAAATCCTGTTACACCGAAGCCACCCTATTACAA
CATTCTGCTGTATTCCTTGGTACCACTAATGTTAATTGCAGGAATTGTCATTTGTGCATTTTGGGTGTACAGACATCACA
AGATGGCCTACCCTCCTGTACTTGTTCCTACTCAA
Sequence Type mRNA
Unitrap ID UNI2248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 48725846..48728993 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052155 (Acvr2a) NM_007396 activin receptor IIA Gene [Source:MGI (curated);Acc:Acvr2a-001]

 
Come back to gene ENSMUSG00000052155


For any suggestions or comments, please send an email to unitrap@crg.es