Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10246G10
Clone ID IST10246G10
Vector VICTR76
Project tigm

Sequence tag IST10246G10HMF2
Sequence
NCAGCAGCCTTGTAATTTAAAGCTCTCCCTGTCGCCTCTAATGCGATCCTCCGGTTTTATTGACTCGCTCTGCGGTCTGT
GGCGCCCCTTCACATCAATCTCCGCTCTAATNACACGGCTGCCACTGCCTGCTCTGCGGAGGCCCANCCCTTTCCTCTAC
TGTCCCCCACCTCCANAACACCAGCCGCCTTCGCTCCAATTCCTTCTGAGCTGTAATGTCATGGTCTGTGGCGGCTGCCT
TCTGCCTCTACCCTCCTGTGAGACCAGGCCCACGGGAGAGCTGCTCTTAANAAATGCTGGGAACNACAGGAAGAAATGGC
TGTGGGACAGGGGTGACTGANAATCTTGGCTAGGGATAGCAGGTAGATGANCCCCGATTTTTTAGAGGCTTTCNTGCCAT
CAACAGTTCANGGCANGAAGGGCAAAACANANNGGGGGCTNANAGCTTCAGANGGGGAAGTCAGAAGCGGGNNGCANAAN
GATTAAAAGTGGGGAACACCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55697117..55697619 463
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST10246G10BBF1
Sequence
CTGGAACTCACTCTGTAGACCAGGCTGGGCTTGAACTCANAAATTCACCTACCTCTGCCTCCCAAGTGCTGGGACCAAAG
GCGTGCGCCACCACGCCTGACAAAATACAAGTTTTTGTTTGTTTGTTTGTTTGTTGTTTTTTTTTNNAANNACNGGACCT
ACNNTTAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es