Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14829B6
Clone ID IST14829B6
Vector VICTR76
Project tigm

Sequence tag IST14829B6BBF1
Sequence
NTGGCCNTGGCNGNNNNGNNNNNAGCAGGCTGGCCTTGAACTCACAGAGATACAGAGATCCACCTGCCTCTGCCTCCCAA
GTGCTGGAATTAAAGGCATATGCCACCNCATCTGGCTTTCANATTTTAATCTTTTTTTAAAGATTTATTTATTTATTTAT
TATATGTAAGTACNCTGTANCTGTCTTCNNACGCACCAGAANAGGGCANCNNATNTG
Sequence Type genomic DNA
Unitrap ID UNI33782

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129296933..129297117 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028795 (Ccdc28b) NM_025455 coiled coil domain containing 28B Gene [Source:MGI (curated);Acc:Ccdc28b-001]


Sequence tag IST14829B6HMF2
Sequence
CTGTGAATAAACATGGTCCCTCCTAAGGTCAGACCAAGCCTATCTGTCTTTCCTTCTTCCATCTCTCTACAGCTGCTTTA
AATAATCTAACAGAATCTAACAGTTTGTGCTTTGAGCATGTGTTGTGAGCATGGGTTTCATTCTTGTGTGCGAGGGGATG
CAGTAAAGAAACTGCTGACATGATTGTTCCAAGATATGGTTAANTTTTTATTGTGGGCATN
Sequence Type genomic DNA
Unitrap ID UNI34093

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84316655..84316874 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027082 (Tfpi) NM_011576 tissue factor pathway inhibitor Gene [Source:MGI (curated);Acc:Tfpi-001]

 
Come back to gene ENSMUSG00000027082


For any suggestions or comments, please send an email to unitrap@crg.es