Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13377E12
Clone ID IST13377E12
Vector VICTR74
Project tigm

Sequence tag IST13377E12HMF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACCAAAACAAACAAAAAAACAAAAAACAAAAATCCAAT
GTGCCTTCATGATCAAAATTCGATAGTCAATAGTACTAGAAGAATCATATGTCTGAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13377E12BBF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI5290 UNI30568 UNI31028 UNI31029 UNI31030 UNI34094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4109106..4109144 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4572067..4572105 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3070240..3070278 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3412198..3412236 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071456 (1110002L01Rik) RIKEN cDNA 1110002L01 gene Gene [Source:MGI Symbol;Acc:MGI:1915821]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3337880..3337918 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8619157..8619195 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3483565..3483603 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3176142..3176180 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3192277..3192315 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5039918..5039956 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024236 (Svil) NM_178046 supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3500413..3500451 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024908 (Saps3) NM_029456 SAPS domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1921807]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3198528..3198566 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4735475..4735513 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3707483..3707521 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042228 (Lyn) NM_010747 Yamaguchi sarcoma viral (v-yes-1) oncogene homolog Gene [Source:MGI (curated);Acc:Lyn-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5215991..5216029 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3065056..3065094 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3183246..3183284 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3078222..3078260 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4021028..4021066 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 22923..22961 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 146692..146730 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 378224..378262 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 230023..230061 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166283: 26685..26723 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 203464..203502 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 3351..3389 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166326: 106856..106894 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166327: 14332..14370 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 106934..106972 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 41238..41276 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 178007..178045 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166436: 108989..109027 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166439: 22234..22272 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166468: 41067..41105 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6136901..6136939 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77847..77885 39
NO GENE  

 
Come back to gene ENSMUSG00000042228


For any suggestions or comments, please send an email to unitrap@crg.es