Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10491D3
Clone ID IST10491D3
Vector VICTR76
Project tigm

Sequence tag IST10491D3BBF1
Sequence
ACCGCATCCTAAAATATAAGTTTTCCCCTTTCAGACTGGCATGGGGGATGTACATTATACGTGTACTACATATTATACAT
ATATAATGTTATATATAACATGCAAAAAGCACTTATTTCAAAATATACCAAAAGACAAAACCAAATAAATAACTAATAGG
TCAAAATTTANTGATGACTATTANAAAATACAAGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108209699..108209894 190
NO GENE  


Sequence tag IST10491D3HMR1
Sequence
GGTATGTGGTGAGAATTTTTAGCCNCTTAGTGTCACC
Sequence Type genomic DNA
Unitrap ID UNI10758

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108209892..108209927 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007815 (Rhoa) NM_016802 ras homolog gene family, member A Gene [Source:MGI Symbol;Acc:MGI:1096342]

 
Come back to gene ENSMUSG00000007815


For any suggestions or comments, please send an email to unitrap@crg.es