Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14418E9
Clone ID IST14418E9
Vector VICTR74
Project tigm

Sequence tag IST14418E9BBF1
Sequence
ATACACAGACTTATTCTTTTTCATTTCATCATTATGGCATTGAAATAGTTATAAAGTAAGCTCAGGCCTAGAATCCCAGC
ACTTGGAAGGCTGAGGCAGGAGGACAGCTGAAAGTTCAAGGATAGCCTGAGCTATGAAGTGAAACCATGTCTAAAAGAAA
AGAAACCAGAAAAAGAAATTAAGAAAGAAAAAAGTGTGAGATAGACTGGCACTGAACCCATTTTACAAGGGCCTACTGAA
CACCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108781327..108781577 251
 
EST/CDNA Est Name
  BB296995.1 - BE286097.1 - BY091740.1 - BY194941.1 - BY128099.1 - BY197587.1 - BY236410.1 - BY046692.1 - BY058265.1 - BY230404.1 - BY236306.1 - BY214386.1 - BY043351.1 - CA545769.1 - CA545320.1 - BY124588.1 - BY133364.1 - CJ079620.1 - BY026082.1 - BY079995


Sequence tag IST14418E9HMR1
Sequence
GTATAACAGACTTTATAGTGCTCTGAAATTTTTCCAATGTCTTATTAATGGTGAATCCATAGTGTTAGTATTGTTTATTT
AGAATTATGAGAAAAGACCTTTTAGGGGATTCTTGGGATACACAGAAGTTTCTGGTAAGAAACTAAGAGCTACCAGGTGG
ATAAGAGAAGCTAATTTGAAATCNTGTAGCTGTGGAAATATGCCTTCCNNAN
Sequence Type genomic DNA
Unitrap ID UNI34097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108781123..108781330 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]


Sequence tag IST14418E9HMF1
Sequence
ATANNNNGNACTTATTCNTTTTNATTTCATCATTATGGCATTGAAATAGTTATAAAGTAAGCTCAGGCCTAGAATCCCAG
CACTTGGAAGGCTGAGGCAGGAGGACAGCTGAAAGTTCAAGGATAGCCTGAGCTATGAAGTGAAACCATGTCTAAAAGAA
AAGAAACCAGAAAAAGAAATTAAGAAAGAAAAAAGTGTGAGATAGACTGGCACTGAACCCATTTTACAAGGGCCTACTGA
ACACCCAGATCTTCCACTAGAATTTTTCTTTTTTTATTGAAAATATAATTTTTTATACAACATATTCTGATTACAGCTTC
CTCTCCCCCAGCTCCTCGAAACCTACAAATACCATACTTTTGAAAAGAGCCTGCNGCCTGAGGACACTGACCTTGTANTC
NNNAAGTCCTCTGANGGGTGATGCAGTGGGACTGANTNNACAGCNCTANNGNCCGANCATGCTCTGANTCCTGACANACC
GACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108781335..108781809 439
 
EST/CDNA Est Name
  BB296995.1 - BI688872.1 - CF167866.1 - BQ896015.1 - CB566637.1 - CF167929.1 - CB600675.1 - CJ134179.1 - CK388730.1 - CF171630.1 - AI050472.1 - AI875325.1 - CK388619.1 - BB628247.1 - AI115919.1 - CK388162.1 - CD354185.1 - BE286097.1 - BB851148.1 - CK388771

 
Come back to gene BB296995.1 - BI688872.1 - CF167866.1 - BQ896015.1 - CB566637.1 - CF167929.1 - CB600675.1 - CJ134179.1 - CK388730.1 - CF171630.1 - AI050472.1 - AI875325.1 - CK388619.1 - BB628247.1 - AI115919.1 - CK388162.1 - CD354185.1 - BE286097.1 - BB851148.1 - CK388771


For any suggestions or comments, please send an email to unitrap@crg.es