Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11804E10
Clone ID IST11804E10
Vector VICTR76
Project tigm

Sequence tag IST11804E10HMF1
Sequence
ACAGTGGCTCAGAATTTCCAGAAACTGTAGTTACCATAGATACAGCGATTGTAAATCATTTCAGGAAATTAAATCCAGCG
ACCAAAACAAGGAGTTATTCTAAACCTGCTCTTTTGACCGAAACGTGAGTTGTTGGACCCCGAGGTGTGTGACGGAAGTG
ACTCAGCAGAGTGCAGCCTCAGGTTACATGCACAGTCTGCCTTTGTCCTCCTGAGTACACAGTGCAGTGCACATACACAG
CACCGCCCTCAGACTTCGCCTCANAGGTTTGCATTGCAATAAGTTCCTGTAACAATGTGGCTTCCATCTGCAAATTCATC
TTAATACTTANCAGCTTGAACCTGGACTGACTGAGGCAGATTACAGGGTCCTTCTGGGGACCCCTGCTTCCGGAGCACTT
CCATCTTCACAGGAAGGANGAGTGCCTTCCTGCCTTNNNCCTTGTTCTCCTCAGACTCGAGTGCTACCCGAGTGAAANCA
NACAGGANGCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27936859..27937352 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es