Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14612C5
Clone ID IST14612C5
Vector VICTR74
Project tigm

Sequence tag IST14612C5BBF1
Sequence
ATCACAGTATTGTTTTAATGAACTTGCATTTANTATTATGTATGGCAAATTCCTATTCAATCGTTAANATGCTCTTCTAG
GTACCAAGTACACAATACAGAATAAGAAAAGAAAAGCCAAACAAAACCCTCTCTTGTGGAATTATAAGAAAATGAAAGTA
CCTAAAAATCTGCTACATGTGCATACCATATGTATTAAGTGAAATAGCAGCAGCAAGGATTTTCTCACAATTCTCACTTT
GCAAATGTCTGGTGTTTTCTTACTAAAACAATAAAAATCACAAGACTTATTAGATACTATTAGCAAGGGGGGTTTTGGAT
GGTTGGTTTTCAAGATAGGGTCTGTAGACCATGCTGGCCTCAACCTCAAAAGCGCTCTGCCTCCAGGGTACTTAGGATTA
AAGGCCTGTGGCACCACACCCAGCTCCATTAGTAAATTTCAATGACAAACTTTCCTTCTAGAACACAGAATCAGTAGGTG
GCCCAAGCTATCCNAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32417819..32418315 491
 
EST/CDNA Est Name
  BY004415.1 - BF237405.1 - CA556645.1 - CA557701.1 - AI463857.1 - CX201349.1 - AA270132.1 - BB639358.1 - CJ124536.1 - CJ120332.1 - BY779550.1 - CJ122741.1 - CJ117138.1 - CJ180274.1 - BQ958093.1 - CJ126116.1 - CJ109545.1 - BE656039.1 - CJ185081.1 - CJ186068


Sequence tag IST14612C5HMR1
Sequence
GTGATTTATAAGACGTGTGAGTTTTAACTAAGAATACCACTGAAGTCTCTAGTAATTGTGGTAAGCTTACTGAGTGGTAT
ACAGTTGCTTAAGTGTACTGCTTTGACTTCCCTATTTAGCAGTTTGCAATGTGGTCAGTAGGTGTAGGCTGTTTCAACCC
TGACCTGCANAAAATATTTTAAAAGGGANAAGTGGGCAAATAAATAAATAAATGTGTATGGGCNNCATGTTTTTCTTTTC
TTTTCTTTTCTTTTTTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32417564..32417823 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es