Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15053G2
Clone ID IST15053G2
Vector VICTR80
Project tigm

Sequence tag IST15053G2HMF1
Sequence
CAACTTTACCCAGAGTTAAAGTAAGTGCTACAAAGTTTGTCGATACCAACCTGGATAGCTTCGGGTAGAGCTATGGAGTT
AAGAGACTGCCACTGTGGTCATTGTGTCTGACAGATCTGCTAAACTGGTCTTATTTTCAGTGACTCAATGAGAAGTTGCT
TTCCCTGGACAGTTCATCTTTAAACAAGCACACCCAAACATCTCAGGGCGGACGGACCAACATTCCTTCCAGAAGCATTC
CAGAATTTCTTTACATTACAATGACTGAATTTGCATTCACCTCCGGTAGACAATGGACACATAAATATGCAAATACCCAT
TTAACCGTTCCTATCCGGCAGTGTTAAAGANCCTCCAACTTCNCCCATCCCTTACCGGAATATCTAANCCATAACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443646..180444041 390
 
EST/CDNA Est Name
  CF167818.1 - AI549786.1 - AA427046.1


Sequence tag IST15053G2BBF1
Sequence
CAACTTTACCCAGAGTTAAAGTAAGTGCTACAAAGTTTGTCGATACCAACCTGGATAGCTTCGGGTAGAGCTATGGAGTT
AAGAGACTGCCACTGTGGTCATTGTGTCTGACAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443646..180443764 119
NO GENE  


Sequence tag IST15053G2HMR1
Sequence
GTTGGATTATNAACTCAAACTTGTGCAAGGGAAGAGGCTGGTATCATGAGGAGAGAAGAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443586..180443649 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es