Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10393B4
Clone ID IST10393B4
Vector VICTR76
Project tigm

Sequence tag IST10393B4HMR1
Sequence
AGAGATACCAATGAAAACAGGTGTGTACAAAGTCTGGCAGGACACTGTCAATCCCTTGTTCCCGTATCTCCACCTTTACT
TGATGCCTAGACCTAGGGGGTCCTCCAGTCTCCTACCTTAGGTTGGCAGGTCTTTGAGGTTCTTTCTGTCTTTCTGTACA
ACTTGGGAAGGTTGGGAGAATTGATCTGGTTCTANGGANCATATGTTCCCCACCATGACNACCATCTCTTTTTTTATGCC
CCTGCTGANCCAGGCCCANANGAACTGGGACN
Sequence Type genomic DNA
Unitrap ID UNI34100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136437819..136438089 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es