Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14590A9
Clone ID IST14590A9
Vector VICTR74
Project tigm

Sequence tag IST14590A9BBF1
Sequence
AGATAAGAAAATAGGTTCTGAGTCCTAGAGACACCTACTGTGGGATGACACAGCTCAAACTCTCCTCCATGCCAGGTAGT
ACCGTGAGGCTACACAGTATACCCCAGGCCTCCAGAACACTGACCGCTACGCAGAGGGTCCAACCTCAATCCTAGGCCTG
GCCTCCCTTCTCCTAGGCATCCTTCAGGGGCCCTAGTGACCATATCATTTGTGAGACGCCCTCTAGATCATCCCCTCCTC
TGGTCCTCATCTCTGACCCCTGTTCTTGTTTGTAGGCCCTCTACAGTAACAACTCCTCCATCCACCTCATTTGACCAAGA
GATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287678..148288002 325
 
EST/CDNA Est Name
  CR519554.1


Sequence tag IST14590A9HMR1
Sequence
ATCTACCCTTCCACCTCTGCCCAGCTGGGCCNGGCACGATGGTCTGGGTAAAGTGGGAATGAAGCTCACCCCC
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287999..148288070 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14590A9HMF1
Sequence
AGATAANAAAATAGGTTCTGAGTCCTAGANACACCTACTGTGGGATGACACAGCTCAAACTCTCCTCCATGCCAGGTAGT
ACCGTGAGGCTACACAGTATACCCCAGGCCTCCAGAACACTGACCGCTACGCAGAGGGTCCAACCTCAATCCTAGGCCTG
GCCTCCCTTCTCCTAGGCATCCTTCAGGGGCCCTANTGACCATATCATTTGTGAGACGCCCTCTAGATCATCCCCTCCTC
TGGTCCTCATCTCTGACCCCTGTTCTTGTTTGTAGGCCCTCTACAGTAACAACTCCTCCATCCACCTCATTTGACCAAGA
GATCTACAGGACGGAACTACTGTTCAGCACAGTGTCTGTCCAATAAATATTTACTGAAATGAACACAGACCGCTAAGANC
TTCTTGCGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287593..148288002 402
 
EST/CDNA Est Name
  CR519554.1

 
Come back to gene CR519554.1


For any suggestions or comments, please send an email to unitrap@crg.es