Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10010C4
Clone ID IST10010C4
Vector VICTR75
Project tigm

Sequence tag IST10010C4BBF1
Sequence
CCATCTCTCCAGCCCGCTCAGCTACTTTTAACCTGGTTCCTTATCCTGCCTGTCGCTTCCCATGGTAGGGGGTTGCTGCC
TCTTGTGATTGGGCACACATCTTCCTCCTGTTCCTCAGCTTCAAATGTCCCTTCCCCTTTCTTTTGGTGTTTCAAAATCC
AAGCTTGCTTCTTCCACAGGACTGAGTCCCCAAAGTGGCACTGAATTCTTCCTGTTTTCTAGTCACTCCATGCTTCTGCA
CGTGCTCCTTCTCTCTGGAATGCTCTTCCTCCTCTCACAGCAAACACTGAATCCTCACCGTGAGTCAAGACTTCCTCTAC
GCTCTAAGCACATTCACTGCTAAAGACGTGGGGTTTTTTGTTTTGTTTTTCCCCCTGTCTCCCTTACCAGGCTATGAGCT
GCTGGAGGGTTGACCCTGCTCACCTGTCCAGTTAGACGTCAGAGTCCAAGACCTGACAAACTAGAAGCTCTCGTCTGTCT
GACTTCACTATCTTGGCCTTTCATTGTGTTCTGATTGCTTTTCCAGTGTTTTCTGCATCTTGGGAGGTAGCATAAGAACA
CTGAGGCTACGAGCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70480839..70481414 576
 
EST/CDNA Est Name
  BI408694.1 - BG865390.1 - BI904800.1 - BQ177344.1 - CA323432.1 - CX241825.1 - BM946226.1 - BE915693.1 - BG293761.1 - CK793649.1 - BB637944.1 - BG247080.1 - CJ132458.1 - CJ071052.1 - BI657181.1 - BG802996.1 - BB618882.1 - BU514065.1 - CA480493.1 - CA979942


Sequence tag IST10010C4BBR1
Sequence
TTGGCTCACGGTTAAGAGGACAGACTGCTCTTCCTGGGAACCTGAGTTAGATTTGCAGACTCCACATCAGGTTCCTTACA
ACTGCCTGTAACCCCAGCTCCTGGGGGGAATCTGACATCTCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI10427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70480717..70480841 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018287 (Spag7) NM_172561 sperm associated antigen 7 Gene [Source:MGI (curated);Acc:Spag7-001]

 
Come back to gene ENSMUSG00000018287


For any suggestions or comments, please send an email to unitrap@crg.es