Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11834H10
Clone ID IST11834H10
Vector VICTR76
Project tigm

Sequence tag IST11834H10HMF1
Sequence
AGCGAGGTGGCACCTTATGTATATCAACACTCTGCGATGGCTGGATTAAAATTTGTGATGCTTAATTGGATTACGAGTGC
ACAAGTTTAGGGCTGCTTTGTAACTCCACTACCAGGGTATCAGACGCCCTCTTCTAATCTCTGCACATACGTACCAAACA
TTCATGCACATAAATGGATTTAAGAAAAAAAAAAATN
Sequence Type genomic DNA
Unitrap ID UNI31406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133838588..133838783 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059772 (Giyd2) NM_029420 GIY-YIG domain containing 2 Gene [Source:MGI (curated);Acc:Giyd2-001]


Sequence tag IST11834H10BBF1
Sequence
AGCGAGGTGGCACCTTATGTATATCAACACTCTGCGATGGCTGGATTAAAATTTGTGATGCTTAATTGGATTACGAGTGC
ACAAGTTTAGGGCTGCTTTGTAACTCCACTACCAGGGTATCAGACGCCCTCTTCTAATCTCTGCACATACGTACCAAACA
TTCNTGCACATAAATGGATTTAAGAAAAAAAAAAATCNAATCCNANNCCTNNGCTNTGCANTTAACCNNNGTCCTTANNT
TANGGTTANNATTTTTTAAAATAAANATTTAAANATNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000059772


For any suggestions or comments, please send an email to unitrap@crg.es