Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14240D3
Clone ID IST14240D3
Vector VICTR74
Project tigm

Sequence tag IST14240D3BBF1
Sequence
CTCTAACAAAGGCAAGCTCCTGGTCAACCGTTTGCAAAGCAGTGTTTGCTTAGTACAGAAGCCCGGGGAATGAGGAAACT
GGTTTGACTGGTTTGCTGGGCGGGAGAGAGCTTAGGGGAACTTTCAACCAACTTTAGAACCAAGGGTATAATGGAAAGGG
AAAGGCTTCTACTGCTAGCCCGCAGGGGGTCCTACATACTCTACTGTATTCNCTGAACTTTTGGTATATGCCCTTAGGAT
ACGTATGCATATGGTTATACCCATTTTGGAGATGGGGATACTAANGCTTANANAANACAGGCCTGGCANNANTCCCAGCT
NNGGGCTCTTGGGTGGTGCNNACTGNTTATTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109134772..109135124 327
 
EST/CDNA Est Name
  BY354194.1


Sequence tag IST14240D3HMR1
Sequence
GAGAAGGAAGTCCAATGGTGTTTTCTTCCTTGCAATGCCGGGAGTGGGTTTGCTGTGCCTTAGAAAGGGTTCAAACTGGG
CTGGAAGTAGGGCCCCAGAGTAGCTGGGGGTTGGGGATTCAGGATGGCCTCAAGTTTGTTGTTCCCCAAACCCTCACTTT
TTCTANAACTATTTCATAATACNCATGCTTAAGGATACCCATTTNNTC
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109135122..109135325 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es