Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13004B7
Clone ID IST13004B7
Vector VICTR76
Project tigm

Sequence tag IST13004B7HMF2
Sequence
GTTTTATGTTCCTTCCNCCCTTATCCCACACCCTTAAAATCCATTCCCACACATATTCACCAGGTTTCTGCTTGAATGAA
TTANCAAACTCATTAAGCTCCTTANTAGTGTANCGAATTTCCTCATGGACTATACTTTCTACCTCCCCTCTAGGAGCCTG
TTTTGCTTTGAGTCTGGTTACAGGTCTAGAANAAACTATTGGTGGGCCNTGANCANACTCTGCAAAATTAATTTCCTCAT
GTGGGGAAGGCATTATTTCNAGAGGTGGGGCTGAGGGTACNACTTCCTNNNGTGGGGCAAACCCTTGANAATCTGAGGAT
TCAAAATTCTCAGCTTCANCATGGTCTTCCCACACATCCCCNTCCCATGTTGTANGATCCCNTTCTTTGCCAATTANAGC
CCTTACTTNNACTGTCNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13004B7BBF1
Sequence
GTTTTATGTTCCTTCCACCCTTATCCCACACCCTTAAAATCCATTCCCACACATATTCACCAGGTTTCTGCTTGAATGAA
TTAGCAAACTCATTAAGCTCCTTAGTAGTGTAGCGAATTTCCTCATGGACTATACTTTCTACCTCCCCTCTAGGAGCCTG
TTTTGCTTTGAGTCTGGTTACAGGTCTAGAANAAACTATTGGTGGGCCGTGAGCANACTCTGCAAAATTAATTTCCTCAT
GTGGGGAAGGCATTATTTCAAGAGGTGGGGCTGAGGGTACTACTTCCTCAGGTGGGGCAAACCCTTGANAATCTGAGGAT
TCAAAATTCTCANCTTCAACATGGTCTTCCCACACATCCCCGTCCCATGTTGTANNAN
Sequence Type genomic DNA
Unitrap ID UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16614744..16615117 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4761012..4761385 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22300403..22300776 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45782332..45782705 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18736098..18736471 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14981092..14981465 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16883517..16883890 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31823825..31824198 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17418043..17418416 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4663027..4663400 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32282645..32283018 366
 
EST/CDNA Est Name
  BY263328.1 - BU149825.1 - BY335821.1 - BY329225.1 - BB862628.1 - BY227476.1 - BY155011.1 - BY253858.1 - BY172576.1 - BY170793.1 - BY005361.1 - BG971146.1 - BY794820.1 - BY778245.1 - BY073912.1 - AI931477.1 - BY088039.1 - BY082454.1 - BB847162.1 - BY080325
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16246866..16247239 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35329851..35330224 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45682994..45683367 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 62667999..62668372 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11075398..11075771 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13776917..13777290 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15697000..15697373 366
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14228783..14229156 366
 
EST/CDNA Est Name
  AV008224.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15515256..15515629 366
NO GENE  

 
Come back to gene AV008224.1


For any suggestions or comments, please send an email to unitrap@crg.es