Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14672B10
Clone ID IST14672B10
Vector VICTR74
Project tigm

Sequence tag IST14672B10HMR1
Sequence
GAAACTCTTTAACAACCTTCCGCCTCATCAGACTCTTGGGAAAGCCTGGCCTTGCATGGGTCCTGAGCCTGCCTCTACCA
CCCAATTAAGCTTTGAGGCCTACTAAGGCCTAAATGCTACTACCAGGGGCAAGGAGTCCCTGACTCCACTGTAAAATCGT
CTTCCTGTGTGGTGCCATGTATCTTGGGCTACCTTACCATCATTCTTGTCATCTACCACTGTAATTACACATTTACAGAC
TGCCTGCTGTTCCTCTGTGGTGAATCCTTAAGCAAAGATGTGTGAGTGTGACTCACCGTGGCCTGGCCCCTGGTACTGAG
CAGGTTCCTGATTGCNTGTATGCCNANCCGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69504400..69504751 346
 
EST/CDNA Est Name
  W71096.1 - AA982021.1 - AW912824.1 - BE654876.1 - AA221610.1 - AA870722.1 - AW763237.1 - BY766420.1


Sequence tag IST14672B10BBF1
Sequence
AGTGAGGTGGGGGTGGAAAAGCGCTCTATACATGTGGGGTACCTGATCTTCTGATACTGTGACATGATGTCCTCTGCAGA
TACATTGGGCCATGTCCATAGCACCCTGAGATGCATGGGGCCCTCTGATGGCTGCAGGTTGCACATGCCTGTAAAAGAAA
ATC
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69504238..69504399 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es