Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14532D11
Clone ID IST14532D11
Vector VICTR74
Project tigm

Sequence tag IST14532D11HMR1
Sequence
CTACGGGCTCTTACGCTCCCTGGGCCTTGCCCTCCCCGACCTCGCGGANCACTTTGAACGAAGCGCCCAGGACACTGCGT
GGGTCAGCGCCCTGGCCTTGGCCGTGCAGCAGGCAGCCAGTGAGGGGGGCCCCCCGAGGTGGGAGGCGGGCACCGGGTGG
AGAGGCCGTGGATGTAGTGATGGGAGACAGCAGACTTGATTACCAGACAACCTGAGAGTTACTGGTGGAACCAAATTCTA
NAAGAGTGGGTCTTGAGGTCNATGGGAGGAGTTACCAGGCCAGGCAAAACAGCCAATGANAAATGTTTCGGATAGTTTGG
GGGTCCCGGGGCATGTCTTCGTTC
Sequence Type genomic DNA
Unitrap ID UNI34117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70028096..70028438 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040938 (Slc16a11) NP_694721 solute carrier family 16 (monocarboxylic acid transporters), member 11 Gene [Source:MGI (curated);Acc:Slc16a11-003]

 
Come back to gene ENSMUSG00000040938


For any suggestions or comments, please send an email to unitrap@crg.es