Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14572D5
Clone ID IST14572D5
Vector VICTR74
Project tigm

Sequence tag IST14572D5BBF1
Sequence
AGAAAAATCTTCCAATGCAACCCAGGAAACTAAAAACAATCACTGCAAGATTCTGAGGCAACATGCCTACGTGCAGCACG
GACTTTCATTTTAATCTCATCTACACCCTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32833404..32833518 113
NO GENE  


Sequence tag IST14572D5HMR1
Sequence
NCTGAAATGTGACTTGTGGACTGATTTGCATAACTTTATAAGCATAGTCATCGTCAGCATGGACGGTGCACATTTGAGGG
TAGAAGTAGTTTTGTGTGTTTAAACCGACGTAATTACAAATTTGGAGCCTGCATTTGGAAGTTTTGTAGTTTAAAATCAA
TAGTGCCAGAATATATATCATTGGAGCTTTTAATANAACTTTGTTAAATTANACTTTCTTTCCTGATGAGATGTGGGATA
GGATATGAAATTTGCATTTCAGTGGTATGTTCNNTTCATTTGACCTCNCCACACTTGATANAATGGANATCNAATANTTT
TTGATCCCN
Sequence Type genomic DNA
Unitrap ID UNI32364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32833517..32833843 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es