Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12356F7
Clone ID IST12356F7
Vector VICTR76
Project tigm

Sequence tag IST12356F7BBF1
Sequence
CTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTC
TCAGGTGTGTTGGGGTTCCCTGGACTGGGCNAANTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTT
ANTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTGACTCTGTTTAGAGATTGT
TCTTCTGGTGATTCTGTTACCGTCTATNANCANACCTGGGAGACANATTCTCTCCTNNGANTTTCAGTGCTCANANCACT
CTCTGCTGGCAAGCTCTCTTACANGGAANGTGCNCANATATCTTGTATTTGNACNNNNNCCTGGCCNAAAAAAAANGCCC
AAAANANGACCTTTCTNNNACANTGTGTTGCTTTGGCAGTTCCCANGTNNTACAGACTCTCACCTAANNNNANTNAATTC
CTAANTTCNNTGNANTCCNGGGANCNAGATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12356F7HMF2
Sequence
CTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTC
TCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTT
AGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTA
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI29644 UNI30806 UNI30807 UNI30808 UNI30809 UNI30810 UNI30811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616001..11616221 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255388..5255608 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826248..7826468 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689469..9689689 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4073941..4074161 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176524..3176744 221
 
EST/CDNA Est Name
  DV072109.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369428..4369648 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14814776..14814996 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11691901..11692121 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10880955..10881175 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647341..20647561 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7842942..7843162 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054703..5054923 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641317..5641537 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987047..3987267 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 9094604..9094824 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046178 (Nxph1) NM_008751 neurexophilin 1 Gene [Source:MGI Symbol;Acc:MGI:107492]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110245..5110465 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912656..3912876 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4770952..4771172 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48337..48557 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114808..115028 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134247..134467 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906147..4906367 221
NO GENE  

 
Come back to gene ENSMUSG00000046178


For any suggestions or comments, please send an email to unitrap@crg.es