Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13850F4
Clone ID IST13850F4
Vector VICTR74
Project tigm

Sequence tag IST13850F4HMF2
Sequence
CTACCACAACTCACGCATTGCATACCACTCACTTACTCAAAATGTATCTTGACTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17216158..17216214 57
NO GENE  


Sequence tag IST13850F4BBF1
Sequence
CTTTGTAGACCAGGCTGACCTTGAACTCAGAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI34122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166673239..166673277 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]

 
Come back to gene ENSMUSG00000074582


For any suggestions or comments, please send an email to unitrap@crg.es