Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10771C2
Clone ID IST10771C2
Vector VICTR76
Project tigm

Sequence tag IST10771C2BBF1
Sequence
GTCTTCAACCNNCCTGANAACACAGCTCAGCAAGCAGTAAAACCTCATGTTTGTGCGGTGGCTGCCTGGCTGCCTGCTGC
AGTCTATACTGTCTCAAAAGGGCCATTTGTAAAGCTTCTGGGAATGGCGCCCGANACTTGTTTATCTGTATAGTAAGTGT
ATCAAAATTCTTTCTGCTANTTAAAGTGTCCTCAATATAAAACTAGCTTACAGCTCTGGGGAGATGACAGAGTGGTTAAN
GGCACTTGCTGCTCTTGCANAAGANCCAGGGTTGGTCCCCTGTATCCACGTGGTGGCTCATAGCTGACNNTAGCTCCAAG
CAACCCAACACCACTTTCCGGGTTTCACAGGTACCTGCACACACACTGGCACCCATCN

Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66544079..66544455 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST10771C2HMF1
Sequence
GTCTTCAACCNGCCTGANAACACAGCTCAGCAAGCAGTAAAACCTCATGTTTGTGCGGTGGCTGCCTGGCTGCCTGCTGC
AGTCTATACTGTCTCAAAAGGGCCATTTGTAAAGCTTCTGGGAATGGCGCCCGAGACTTGTTTATCTGTATAGTAAGTGT
ATCAAAATTCTTTCTGCTAGTTAAAGTGTCCTCAATATAAAACTAGCTTACAGCTCTGGGGAGATGACAGAGTGGTTAAN
GGCACTTGCTGCTCTTGCANAAGACCCAGGGTTGGTCCCCTGTATCCACGTGGTGGCTNATANCTGACCATAGCTCCNAN
CANCCCANCNCCACTTTCCGGGTTTNACAGGTACNNGCACACACNCTGGCACCNATNNNCNCGCNCNCNCNCACACNCAC
ACNCNCACNNNCACAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es