Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14981H8
Clone ID IST14981H8
Vector VICTR76
Project tigm

Sequence tag IST14981H8HMR1
Sequence
AAAGCCNATTTAGTAAGCTCCTATCTCCANATTAAAAGTAAAACTGAGCATAATGGCATGTGCCAATCCTAGCACTTGGG
AGACTAAGGGCATCCTCAGCTACATTGTAAGTTAGGTAGCCTTTGTTATGGCCCACCTCAGGAACTGATTCTGACTGACT
CTGGGGGAGACAGAGTCAGTATTTTTAAGGGTGTAACCCCTGCTGATTGACCAGACTTCAGTAAATGGCCCTATTATCNN
GAGAGTGCGGATAGAACAAATTGGACTCTGGGCTATTTTAAAGAAAGTCAGAAATAGGGCTCAGATGGTTAAGAGCACTG
ACTGCTCTTCCANANGTCCTGAGTTCAATTCCCAGCAACCACATGGCNACTCACAACAACCTGTAATGGGGCTCANTGTC
CTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTATTCATATACNTANNATANATAAAATCTTTTTTTTTAAAGAAAGTCN
AAATANCACTTAATTGGGAGAN
Sequence Type genomic DNA
Unitrap ID UNI1451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65615653..65616153 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es