Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14132G3
Clone ID IST14132G3
Vector VICTR74
Project tigm

Sequence tag IST14132G3HMR1
Sequence
NGTTNANNAAANANAAAAATATTCANGTTCTTTCTACAACTAGGTGGACATTTTCCAGGAATGGGGTGGGGTGGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14132G3HMF2
Sequence
NNTCTTTATTCCTTCCTCTCTGNCTTTCCCTCCTCCTTTTCTCCTCGTCTCGCCTTTCCTGTTATTTCTTTTTTCTCCTT
TTTTTTCCTCTCCCATTTTCTCCCTCCCACTGCCTCCACACTCTCTCTTGACAAGGATTCACTGTTTGGTCCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61805673..61805827 153
NO GENE  


Sequence tag IST14132G3BBF1
Sequence
ATTGAAATATGTAATTGTGTTAAATCTTTTCTCTGAGTGTCCCCTCCCCTGCCCCACACCATCCCTGAGNTCTG
Sequence Type genomic DNA
Unitrap ID UNI33565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109573094..109573166 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031916 (Cog8) NM_139229 component of oligomeric golgi complex 8 Gene [Source:MGI (curated);Acc:Cog8-001]

 
Come back to gene ENSMUSG00000031916


For any suggestions or comments, please send an email to unitrap@crg.es