Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14569D10
Clone ID IST14569D10
Vector VICTR74
Project tigm

Sequence tag IST14569D10BBF1
Sequence
CAATGTCTGTAATTCTAGCTGCAGTCCCTTAGTGGCCCTTTTATGATCTGTTTTTCCAGGACACCTTTGATGGAAGGACA
GGAAGTCTGCATTTAGTGTCTTTAAATCCTGGGGCAACCTGGTCCAGGTCTATTGCCTGCTTCAATCTCACACTGGGTCT
GTCTATTTAAAATAGCAAAGATGGGTTGACTCACCTCTGCCAATGGGTGGCTGAGGAACACATTTTATAGGTCTAAGAGG
GTATATATAATCTGTTTCTCTAGAANAAACAGACTCATGANAATCAAAGGTTCCAGGTACCTTCNTAGGTANAAGAGGCC
TGTTCTATGGTGACTGGCNGGNCACCGGGANNCCTGTCTNNTNANNCN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114423325..114423683 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST14569D10HMF2
Sequence
TGGTGAGGTCCAGACCAGCCAAAGTTACATACTGAGATACTGTCTCTAAAACAAAAATATGTATCAGATAATGTACAAGA
ATTTTTATTAGTTCTGTTATATTGGTGGCATTTTGGCATTAATTGAAAAGATAATACGATTACTTGTTATGTTGATTACA
CAATTAAGTCTTCAAGGGTGAAGGTATACTGATATTCATATATTTATATAATTTACTATATGATGTAAGCAAATATGGAA
AAACACTTAGCGGTCACTCCTANGTGCGATGGACTGNNCGCCTGTACCTTTGGGAACCCACATACTGAAACTATAGGATA
NCAGTANCAAGTCGGGAATGAANCATTTATGTCATGGANANTTNNTCTCTCCATGAAANANCTCGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10002662..10003047 362
NO GENE  

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es