Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10815G9
Clone ID IST10815G9
Vector VICTR76
Project tigm

Sequence tag IST10815G9HMF1
Sequence
TTCACAATAATATATGGGGATGATCACATAGGAAATACAACCAACTGCACTGGTCATCGCTGGTGGAGAGTCCCTTTCTT
ACAGTCACAAGGCATTGGATTAAAACTTCAGCAGAGCTTACTTAACAAGGTAAAACCAAAATACCACTGGGTTAAAATGG
GTGAACTTTACAGTATGTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21140856..21141034 179
NO GENE  


Sequence tag IST10815G9HMR1
Sequence
GAACACCCTCTTCTNAACCCTTCTCTTCTCCTAATTTTTTGCCTCACCCCTACTGTTCTCCATGAANCNTTAATCTACTT
TTTAAATTTATTTACTTAATGTGAGTCTTTCACATAAATGATGTGAAATTATAGCTTTTTGAAAAATTATTTTAAAGTCA
ATATACATACNTACATATATACATATATATACATACACACACACACACACACACACACNNNNATATATATATACATATAT
ATATAANNNTTGNNCNNNGN
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21141032..21141277 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es