Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14915B1
Clone ID IST14915B1
Vector VICTR76
Project tigm

Sequence tag IST14915B1HMF1
Sequence
CTCACTATGTGTGACTGGGAAGTAAAAATAATCTTATAGCAGTTGGCAGTATGCTGGCTTAGGGTGCGAGCAGTCCTGGG
TTCCATCTCCAGCACTGCATAAACAGTGGAAGTGGCATGTGCCCGTAATGCCAGATATTTTGGGAATGTTAATAATAAAA
TAACTTACCTCAAAGAGGTTAAGAGGAGCCAAATATGTGGA
Sequence Type genomic DNA
Unitrap ID UNI33424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74351710..74351909 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026179 (Pnkd) NM_019999 paroxysmal nonkinesiogenic dyskinesia Gene [Source:MGI (curated);Acc:Pnkd-001]

 
Come back to gene ENSMUSG00000026179


For any suggestions or comments, please send an email to unitrap@crg.es