Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14887D11
Clone ID IST14887D11
Vector VICTR76
Project tigm

Sequence tag IST14887D11HMF2
Sequence
ACAGAAGAAAATAGTAACAAATATTCTATCTCATTGTTTGCCTTGTGTGTCCTTAGAAGGTCCAGCAACACATCCATGCC
CCCTGGGCAAGCGCTAATTCCCTGGTGTGTGGTCTTGGGCCCACACCGCAAGGCTGGTCCTCAGAAAGCTCTGGTTCGCC
GCCTTAACTGTCTGTAGCATAAAGATTGATCCTTGGGGTTTTGATCGGTTCTTAATGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82969080..82969301 222
 
EST/CDNA Est Name
  BY330894.1 - BY330802.1


Sequence tag IST14887D11HMR1
Sequence
TGTGACAACTTTTATTTATAGCTTTAGGCAGTCTTTTGGCATGGCCTGTTGCCTGCGCTTTTAAATTTTACATTCGTAAT
CCAGGTAACACACTACTACGGTACTTTGACCATCTACTACTTCCTCAAGAGTTTCTAACGTTCCCTCTTGTGTATACATT
AAATAGCCNCAGTCTTGGCATGATGGAGGCTGTTGTACANTCTCAATANCTTATCCCAGGCTTGTCTCCAACTGCTTCCC
TGTNNNTNACCN
Sequence Type genomic DNA
Unitrap ID UNI8596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82968840..82969082 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es