Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14494E12
Clone ID IST14494E12
Vector VICTR74
Project tigm

Sequence tag IST14494E12HMR1
Sequence
AGGAATGAATCTAGTTTGTCTTTACTATAAGATGGCTTTCAAACTTAAGATGGAGACAGGCTAAAAAGATGACAAAAAAC
AAAACAAAACAAAAAACAACAACNACNAANAAGATGGAGACAGGCTGGTTCATCTTGGAATTANTAGTGCCAAGGCTATT
TTTTAAGCAGCACAAGAGAGAGANANCTTTCCTCTTACATCTTTTGTTTTATTTNANCCTTTGAGATTTAAGAAAAAAAT
TGTTTTCTATTTTTNAATANAGGTATTCTTTCTGGATCTNGC
Sequence Type genomic DNA
Unitrap ID UNI15804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29739834..29740112 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]


Sequence tag IST14494E12HMF1
Sequence
CCTGTTTATGATTAAACCTCTGGTTCTNAAAGATTAAGTCTAACTACAAATGGTTCTGTACTGCCTATTCCAGGAAACAG
CAATCACACCTTTGTGTCAAAAGGTTACTATGACACCTGTTGTTCCAACCACCTTGCAGCCATGTCTTTGTTTCCGGTCA
CTATGACCCATTTTATTATGCTTGTGTAGTCTTACCTCTGTAACCCATCTATTTCCCTGCCAAATCCCTCGTTTANAAAC
CCCCTAAAACTCCTGGACTGTAAGGACCTTATCTTCTACTTGTCCACCGCTGATCTCTAGAAACCTACTTTCAAAGACAG
CCTGTGTACNCAAATAAAAATAAATAAATAAATAAATAAATNAAAANCTTGNTTTAATTAACTGCTTGGTTNAATTAATT
TGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29739431..29739836 392
NO GENE  

 
Come back to gene ENSMUSG00000029772


For any suggestions or comments, please send an email to unitrap@crg.es